Fragment that contains the cdN protein coding sequence, PCR reactions using

Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and 59GCTCTAGATTCCCGCTGCGCAGCTCC39) were performed. After PCR, the DNA fragment was digested 1317923 with restriction enzymes (EcoRI/XbaI) and inserted into the pcDNA3.1-V5-His A (Invitrogen, USA) vector for transient expression in mammalian cells. To clone the full-length cdN DNA fragment for yeast twohybrid screening (a.a. 1?01), primers (59CCGAATTCGCATGGCGCGGAGCGTGCGC39and 59CCGCTCGAGTCATTCCCGCTGCGCAGC39) were used to perform PCR. After PCR, the DNA fragment was digested with restriction enzymes (EcoRI and XhoI) and cloned into the pACT2 (Clontech, USA) expression vector (linearized with EcoRI/XhoI). The same forward primer and a different BIBS39 web reverse primer (59CCGCTCGAGTTAGTACACACTGGCCAC39) were used to clone the DNA fragment that contained the first 65 codons of the cdN Methionine enkephalin sequence for yeast two-hybrid screening. The same reverse primer and a different forward primer (59CCGAATTCGCGGTGAGAAGTACCGC39) were used to clone the DNA fragment encoding the C-terminal 92 a.a. of cdN protein (a.a. 110-201). The oligonucleotide primers (59CCGAATTCGCGAAGCCCCGGGCTTT39and 59CCGCTCGAGTTACACACAGTGGTGGTA39) were used to clone the DNA fragment encoding cdN protein from a.a. 66 to a.a. 109. To construct the expression plasmid for a.a. 846 to 1008 of ELKS-d protein [10], the DNA fragment was amplified by PCR from the cDNA library of HuH7 cells using primers (59CGGAATTCGCGTGGAGGAGTTACTGATGGC39 1315463 and 59CCGCTCGAGTCAGTCATGGCAGAGGGTTG39). After amplification, the DNA fragment was digested with restriction enzymes (EcoRI and XhoI) and cloned into the pACT2 expression vector (linearized with EcoRI/XhoI). All the expression plasmids were verified by sequencing.used for this screening was a human fetal liver library, HL4029AH (Clontech).Cell CultureHuH7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin (Gibco, USA) [13]. HCV sub-genomic replicon cells were cultured in DMEM with 10 FBS, 100 U/ml penicillin, 100 mg/ml streptomycin and 400 mg/ml G418 [14]. All cultured cells were maintained at 37uC with 5 CO2.DNA TransfectionThe ExGen 500 in vitro transfection reagent (Fermentas, USA) was used to transfect DNA (e.g., pcDNA3.1-cdN or pcDNA3-mycNS3/4A) into HuH7 cells following the manufacturer’s instructions.Western Blotting AnalysisOur previous procedures were followed for Western blotting analysis [11,12,13]. The primary antibodies used for the analyses in this study were goat anti-cdN polyclonal antibody (Santa Cruz, USA), mouse anti-NS5A monoclonal antibody (Biodesign, USA), mouse anti-myc (4A6) monoclonal antibody (Upstate, USA), mouse anti-V5 monoclonal antibody (Serotec, USA), mouse anti-actin monoclonal antibody (Santa Cruz), mouse anti-NS3 monoclonal antibody (Santa Cruz), mouse anti-mdN monoclonal antibody (Abnova, USA) and rabbit anti-Erk2 polyclonal antibody (Santa Cruz).Immunoprecipitation and Western Blotting Analysis3?6106 cells were seeded in a 100-mm culture dish. After overnight incubation, cells were transfected with 2 ug plasmid DNA using the ExGen 500 in vitro transfection reagent. At 48 hours after transfection, cells were lysed in 1 ml RIPA (50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 4 mM EDTA, pH 8.0, 0.5 Trition-X 100, 0.1 SDS and 0.5 sodium deoxycholate). After centrifugation for five minutes, the supernatant was incubated with the anti-V5 ant.Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and 59GCTCTAGATTCCCGCTGCGCAGCTCC39) were performed. After PCR, the DNA fragment was digested 1317923 with restriction enzymes (EcoRI/XbaI) and inserted into the pcDNA3.1-V5-His A (Invitrogen, USA) vector for transient expression in mammalian cells. To clone the full-length cdN DNA fragment for yeast twohybrid screening (a.a. 1?01), primers (59CCGAATTCGCATGGCGCGGAGCGTGCGC39and 59CCGCTCGAGTCATTCCCGCTGCGCAGC39) were used to perform PCR. After PCR, the DNA fragment was digested with restriction enzymes (EcoRI and XhoI) and cloned into the pACT2 (Clontech, USA) expression vector (linearized with EcoRI/XhoI). The same forward primer and a different reverse primer (59CCGCTCGAGTTAGTACACACTGGCCAC39) were used to clone the DNA fragment that contained the first 65 codons of the cdN sequence for yeast two-hybrid screening. The same reverse primer and a different forward primer (59CCGAATTCGCGGTGAGAAGTACCGC39) were used to clone the DNA fragment encoding the C-terminal 92 a.a. of cdN protein (a.a. 110-201). The oligonucleotide primers (59CCGAATTCGCGAAGCCCCGGGCTTT39and 59CCGCTCGAGTTACACACAGTGGTGGTA39) were used to clone the DNA fragment encoding cdN protein from a.a. 66 to a.a. 109. To construct the expression plasmid for a.a. 846 to 1008 of ELKS-d protein [10], the DNA fragment was amplified by PCR from the cDNA library of HuH7 cells using primers (59CGGAATTCGCGTGGAGGAGTTACTGATGGC39 1315463 and 59CCGCTCGAGTCAGTCATGGCAGAGGGTTG39). After amplification, the DNA fragment was digested with restriction enzymes (EcoRI and XhoI) and cloned into the pACT2 expression vector (linearized with EcoRI/XhoI). All the expression plasmids were verified by sequencing.used for this screening was a human fetal liver library, HL4029AH (Clontech).Cell CultureHuH7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10 fetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin (Gibco, USA) [13]. HCV sub-genomic replicon cells were cultured in DMEM with 10 FBS, 100 U/ml penicillin, 100 mg/ml streptomycin and 400 mg/ml G418 [14]. All cultured cells were maintained at 37uC with 5 CO2.DNA TransfectionThe ExGen 500 in vitro transfection reagent (Fermentas, USA) was used to transfect DNA (e.g., pcDNA3.1-cdN or pcDNA3-mycNS3/4A) into HuH7 cells following the manufacturer’s instructions.Western Blotting AnalysisOur previous procedures were followed for Western blotting analysis [11,12,13]. The primary antibodies used for the analyses in this study were goat anti-cdN polyclonal antibody (Santa Cruz, USA), mouse anti-NS5A monoclonal antibody (Biodesign, USA), mouse anti-myc (4A6) monoclonal antibody (Upstate, USA), mouse anti-V5 monoclonal antibody (Serotec, USA), mouse anti-actin monoclonal antibody (Santa Cruz), mouse anti-NS3 monoclonal antibody (Santa Cruz), mouse anti-mdN monoclonal antibody (Abnova, USA) and rabbit anti-Erk2 polyclonal antibody (Santa Cruz).Immunoprecipitation and Western Blotting Analysis3?6106 cells were seeded in a 100-mm culture dish. After overnight incubation, cells were transfected with 2 ug plasmid DNA using the ExGen 500 in vitro transfection reagent. At 48 hours after transfection, cells were lysed in 1 ml RIPA (50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 4 mM EDTA, pH 8.0, 0.5 Trition-X 100, 0.1 SDS and 0.5 sodium deoxycholate). After centrifugation for five minutes, the supernatant was incubated with the anti-V5 ant.